Transcript: Mouse NM_001159646.1

Mus musculus deoxyuridine triphosphatase (Dut), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Dut (110074)
Length:
2263
CDS:
25..627

Additional Resources:

NCBI RefSeq record:
NM_001159646.1
NBCI Gene record:
Dut (110074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080604 CGGATTTCTTATCCAGACTTA pLKO.1 538 CDS 100% 4.950 6.930 N Dut n/a
2 TRCN0000295539 ACGTTCTGGCTTGGCTGTAAA pLKO_005 384 CDS 100% 13.200 10.560 N Dut n/a
3 TRCN0000295482 CCTATTCAGTGCCTATGATTA pLKO_005 279 CDS 100% 13.200 9.240 N Dut n/a
4 TRCN0000080603 GCTGGAAGTATCTCGCTGTTT pLKO.1 634 3UTR 100% 4.950 3.465 N Dut n/a
5 TRCN0000298410 GCTGGAAGTATCTCGCTGTTT pLKO_005 634 3UTR 100% 4.950 3.465 N Dut n/a
6 TRCN0000080606 CGAGGATTACAGAGGAAACGT pLKO.1 438 CDS 100% 3.000 2.100 N Dut n/a
7 TRCN0000288247 CGAGGATTACAGAGGAAACGT pLKO_005 438 CDS 100% 3.000 2.100 N Dut n/a
8 TRCN0000080605 CGTGCTGTTTAACTTTGGGAA pLKO.1 465 CDS 100% 2.640 1.848 N Dut n/a
9 TRCN0000080607 GCCATCGTGAAGACAGACATT pLKO.1 322 CDS 100% 4.950 2.970 N Dut n/a
10 TRCN0000288187 GCCATCGTGAAGACAGACATT pLKO_005 322 CDS 100% 4.950 2.970 N Dut n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.