Transcript: Human NM_001159727.2

Homo sapiens phospholipase B domain containing 2 (PLBD2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PLBD2 (196463)
Length:
4691
CDS:
15..1688

Additional Resources:

NCBI RefSeq record:
NM_001159727.2
NBCI Gene record:
PLBD2 (196463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413389 TCGAGTATGAAGTCGGCTACT pLKO_005 448 CDS 100% 4.050 5.670 N PLBD2 n/a
2 TRCN0000432061 TCTTCTGCCCTGCCCTAAATC pLKO_005 1902 3UTR 100% 13.200 9.240 N PLBD2 n/a
3 TRCN0000005049 CCTTGAGGACAGAAACTTGAA pLKO.1 2225 3UTR 100% 4.950 3.465 N PLBD2 n/a
4 TRCN0000005053 GCTGATGAGGTACAATGACTT pLKO.1 1349 CDS 100% 4.950 3.465 N PLBD2 n/a
5 TRCN0000005052 GCTGCGTGTCATCAAGAAGTA pLKO.1 824 CDS 100% 4.950 3.465 N PLBD2 n/a
6 TRCN0000005050 GCAGGAAGAGATGGAGTCAAA pLKO.1 512 CDS 100% 4.950 2.970 N PLBD2 n/a
7 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2918 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
8 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2952 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.