Transcript: Mouse NM_001159730.1

Mus musculus phosducin (Pdc), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pdc (20028)
Length:
1263
CDS:
109..843

Additional Resources:

NCBI RefSeq record:
NM_001159730.1
NBCI Gene record:
Pdc (20028)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034467 CCTACGTTGCTGGTGTACAAA pLKO.1 661 CDS 100% 5.625 7.875 N Pdc n/a
2 TRCN0000064097 CAGGACCCAAAGGAGTAATAA pLKO.1 167 CDS 100% 15.000 10.500 N PDC n/a
3 TRCN0000034465 CCCAAAGGAGTAATAAATGAT pLKO.1 172 CDS 100% 5.625 3.938 N Pdc n/a
4 TRCN0000034464 CCCAATGGTCAAGTTCTGTAA pLKO.1 588 CDS 100% 4.950 3.465 N Pdc n/a
5 TRCN0000034466 GCCTAGGTATGGGTTTGTGTA pLKO.1 426 CDS 100% 4.950 3.465 N Pdc n/a
6 TRCN0000034468 GAATATGGATTACTACCAGAA pLKO.1 769 CDS 100% 4.050 2.835 N Pdc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.