Transcript: Human NM_001159746.3

Homo sapiens ABR activator of RhoGEF and GTPase (ABR), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ABR (29)
Length:
5553
CDS:
551..2992

Additional Resources:

NCBI RefSeq record:
NM_001159746.3
NBCI Gene record:
ABR (29)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159746.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047951 GCGTTTGTCGATAACTATAAA pLKO.1 968 CDS 100% 15.000 21.000 N ABR n/a
2 TRCN0000416392 TCCCGTTCAGGATCCACAATC pLKO_005 1686 CDS 100% 10.800 15.120 N ABR n/a
3 TRCN0000431542 ACAACCTGGCTACCGTGTTTG pLKO_005 2793 CDS 100% 10.800 7.560 N ABR n/a
4 TRCN0000047952 CTGTGCTATGAGAAGTGCTAT pLKO.1 2114 CDS 100% 4.950 3.465 N ABR n/a
5 TRCN0000047948 GCGCCTGAAGAAGAAGATGTT pLKO.1 1627 CDS 100% 4.950 3.465 N ABR n/a
6 TRCN0000047950 CGTGATTGAGATGAACGGGAT pLKO.1 2245 CDS 100% 2.160 1.512 N ABR n/a
7 TRCN0000047949 CGAGACCATCTTCTACAAGAT pLKO.1 820 CDS 100% 0.495 0.347 N ABR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159746.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.