Transcript: Mouse NM_001159864.1

Mus musculus potassium channel tetramerisation domain containing 18 (Kctd18), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Kctd18 (51960)
Length:
2615
CDS:
99..1388

Additional Resources:

NCBI RefSeq record:
NM_001159864.1
NBCI Gene record:
Kctd18 (51960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159864.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216952 CTAGATATCCTTCGGCTGAAT pLKO.1 162 CDS 100% 4.950 6.930 N Kctd18 n/a
2 TRCN0000198827 CCGCTTTAAGGATTCTATGCT pLKO.1 224 CDS 100% 3.000 4.200 N Kctd18 n/a
3 TRCN0000198575 GCCAATGAGATGGAGACATAT pLKO.1 453 CDS 100% 13.200 9.240 N Kctd18 n/a
4 TRCN0000197857 GTGATGGACATCTATTCAAAT pLKO.1 310 CDS 100% 13.200 9.240 N Kctd18 n/a
5 TRCN0000147418 GTTCAGTACATTTGGAGCTAT pLKO.1 714 CDS 100% 4.950 3.465 N KCTD18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159864.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.