Transcript: Mouse NM_001160304.1

Mus musculus predicted gene 4788 (Gm4788), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
Gm4788 (214403)
Length:
2710
CDS:
72..2534

Additional Resources:

NCBI RefSeq record:
NM_001160304.1
NBCI Gene record:
Gm4788 (214403)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001160304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270209 GAAGTGAAATCTTGTGAATTT pLKO_005 141 CDS 100% 13.200 9.240 N Gm4788 n/a
2 TRCN0000270191 TCTTGTGAAAGACCAGTATTT pLKO_005 702 CDS 100% 13.200 9.240 N Gm4788 n/a
3 TRCN0000270188 CAACCTCCTGAAATTCCTAAT pLKO_005 1074 CDS 100% 10.800 7.560 N Gm4788 n/a
4 TRCN0000270235 TTTCACCACCTTCTGGGATTT pLKO_005 262 CDS 100% 10.800 7.560 N Gm4788 n/a
5 TRCN0000270190 GATGGACCAGCACTTATTAAA pLKO_005 2094 CDS 100% 15.000 9.000 N Gm4788 n/a
6 TRCN0000255030 TATCAGTGCCAGAAGTATTAT pLKO_005 2250 CDS 100% 15.000 7.500 Y Cfhr2 n/a
7 TRCN0000255029 AGGAAATAAGTACAGCTATAA pLKO_005 227 CDS 100% 13.200 6.600 Y Cfhr2 n/a
8 TRCN0000216383 GGAAATAAGTACAGCTATAAG pLKO.1 228 CDS 100% 13.200 6.600 Y Cfhr2 n/a
9 TRCN0000216103 CAATAGAACATGGATCTATTA pLKO.1 1798 CDS 100% 1.320 0.660 Y Gm4788 n/a
10 TRCN0000255033 TTTCGTACAAAGTGCATTAAT pLKO_005 2484 CDS 100% 15.000 7.500 Y Cfhr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.