Transcript: Human NM_001160332.1

Homo sapiens neurofascin (NFASC), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
NFASC (23114)
Length:
10153
CDS:
329..3853

Additional Resources:

NCBI RefSeq record:
NM_001160332.1
NBCI Gene record:
NFASC (23114)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001160332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155083 GACACGAAACAGCAGATTCTT pLKO.1 535 CDS 100% 5.625 7.875 N NFASC n/a
2 TRCN0000155244 GCCATCGAAATTCCTATGGAT pLKO.1 398 CDS 100% 3.000 4.200 N NFASC n/a
3 TRCN0000157793 CGGAGACCTATACTTCTCCAA pLKO.1 892 CDS 100% 0.264 0.370 N NFASC n/a
4 TRCN0000155494 CCATCTGATAAGGCCAAGTTT pLKO.1 1223 CDS 100% 5.625 4.500 N NFASC n/a
5 TRCN0000094172 CGATGGTTTAAGAATGGGCAA pLKO.1 1748 CDS 100% 2.160 1.728 N Nfasc n/a
6 TRCN0000158384 CCTCACCAACCACCCTTATAA pLKO.1 1009 CDS 100% 15.000 10.500 N NFASC n/a
7 TRCN0000156784 GCAGACCGACTACAGTTGTAA pLKO.1 931 CDS 100% 5.625 3.938 N NFASC n/a
8 TRCN0000158385 CCCTTGGAGGTTGATTGACTT pLKO.1 121 5UTR 100% 4.950 3.465 N NFASC n/a
9 TRCN0000157822 CCAAGACAAACGTGTCTCTCA pLKO.1 862 CDS 100% 0.264 0.185 N NFASC n/a
10 TRCN0000156269 CACCCTGACATGTACAGTGAT pLKO.1 1049 CDS 100% 4.950 2.970 N NFASC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.