Transcript: Mouse NM_001160415.1

Mus musculus apolipoprotein B mRNA editing enzyme, catalytic polypeptide 3 (Apobec3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Apobec3 (80287)
Length:
2459
CDS:
110..1399

Additional Resources:

NCBI RefSeq record:
NM_001160415.1
NBCI Gene record:
Apobec3 (80287)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001160415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197906 GTGCTATGAAGTGACTAGAAA pLKO.1 241 CDS 100% 5.625 7.875 N Apobec3 n/a
2 TRCN0000176752 CGCCATCAATAGGTACTTAAT pLKO.1 1720 3UTR 100% 13.200 10.560 N Apobec3 n/a
3 TRCN0000176977 GAAACCTGATATCTCAAGAAA pLKO.1 162 CDS 100% 5.625 3.938 N Apobec3 n/a
4 TRCN0000197767 GATACCTTCTTGTGCTATGAA pLKO.1 230 CDS 100% 5.625 3.938 N Apobec3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.