Transcript: Mouse NM_001161516.1

Mus musculus dCMP deaminase (Dctd), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dctd (320685)
Length:
1877
CDS:
57..611

Additional Resources:

NCBI RefSeq record:
NM_001161516.1
NBCI Gene record:
Dctd (320685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119759 CCGTGTAACGAATGTGCTAAA pLKO.1 399 CDS 100% 10.800 15.120 N Dctd n/a
2 TRCN0000119757 CCTTGGTTTGTTGGTCACATA pLKO.1 1290 3UTR 100% 4.950 6.930 N Dctd n/a
3 TRCN0000119760 GTTATCTTCATGTCGGATAAA pLKO.1 447 CDS 100% 1.320 1.848 N Dctd n/a
4 TRCN0000426773 TTGACTTTGATTCGATCAATA pLKO_005 565 CDS 100% 13.200 10.560 N Dctd n/a
5 TRCN0000413483 ATAATTGCTTCTCGTTCTTAG pLKO_005 989 3UTR 100% 10.800 8.640 N Dctd n/a
6 TRCN0000427476 CTCTGTCATCCACCATATTTC pLKO_005 925 3UTR 100% 13.200 9.240 N Dctd n/a
7 TRCN0000344022 TCATCATCCAGGCAGGTATAA pLKO_005 421 CDS 100% 13.200 9.240 N DCTD n/a
8 TRCN0000051876 AGCAAGATTGTCATTGACTTT pLKO.1 552 CDS 100% 4.950 3.465 N DCTD n/a
9 TRCN0000119758 GCTGGATACTAAATATCCTTA pLKO.1 296 CDS 100% 0.495 0.347 N Dctd n/a
10 TRCN0000119761 CCTTCTTGTCAGCACAAAGAA pLKO.1 142 CDS 100% 0.563 0.338 N Dctd n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 663 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000178741 CACACACATACACACACACAA pLKO.1 679 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.