Transcript: Mouse NM_001161548.1

Mus musculus transmembrane protein 184a (Tmem184a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tmem184a (231832)
Length:
2039
CDS:
160..1509

Additional Resources:

NCBI RefSeq record:
NM_001161548.1
NBCI Gene record:
Tmem184a (231832)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217840 CTGCATTGTGAAACCCGTTAT pLKO.1 807 CDS 100% 10.800 15.120 N Tmem184a n/a
2 TRCN0000173736 CGAGACTGCTACGAAGCATTT pLKO.1 610 CDS 100% 10.800 8.640 N Tmem184a n/a
3 TRCN0000175407 CCCTTGCATTCTAACCTAGAA pLKO.1 1902 3UTR 100% 4.950 3.960 N Tmem184a n/a
4 TRCN0000437397 GTGAAGTCACCTGGGCAAATT pLKO_005 1662 3UTR 100% 13.200 9.240 N Tmem184a n/a
5 TRCN0000432784 AGCACCTATGCAAAGCATATC pLKO_005 1257 CDS 100% 10.800 7.560 N Tmem184a n/a
6 TRCN0000243150 TCAAGTTCCTCACCATCAAAG pLKO_005 1007 CDS 100% 10.800 7.560 N TMEM184A n/a
7 TRCN0000173183 CCAGGACGCCATTCATAACTT pLKO.1 1317 CDS 100% 5.625 3.938 N Tmem184a n/a
8 TRCN0000175442 CTGCTACGAAGCATTTGTCAT pLKO.1 615 CDS 100% 4.950 3.465 N Tmem184a n/a
9 TRCN0000176268 CATAGAGAAACGCATGCTGAT pLKO.1 1470 CDS 100% 4.050 2.835 N Tmem184a n/a
10 TRCN0000173272 CTCCATCACGTTCTTACGCTT pLKO.1 762 CDS 100% 2.640 1.848 N Tmem184a n/a
11 TRCN0000217758 CAGCACCTATGCAAAGCATAT pLKO.1 1256 CDS 100% 10.800 6.480 N Tmem184a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.