Transcript: Mouse NM_001161621.1

Mus musculus amine oxidase, copper-containing 1 (Aoc1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Aoc1 (76507)
Length:
2831
CDS:
207..2477

Additional Resources:

NCBI RefSeq record:
NM_001161621.1
NBCI Gene record:
Aoc1 (76507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076671 GCCACTTTGACTCAAACTTTA pLKO.1 1507 CDS 100% 13.200 10.560 N Aoc1 n/a
2 TRCN0000222672 CGCCACTTTGACTCAAACTTT pLKO.1 1506 CDS 100% 5.625 4.500 N Aoc1 n/a
3 TRCN0000076672 CCTCATGACAAAGCAAGGATA pLKO.1 297 CDS 100% 4.950 3.465 N Aoc1 n/a
4 TRCN0000076670 GCTGTGACAAAGTATCGGGAA pLKO.1 2088 CDS 100% 2.160 1.512 N Aoc1 n/a
5 TRCN0000076668 GCAAAGGAAGATCACAGAATT pLKO.1 2662 3UTR 100% 0.000 0.000 N Aoc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.