Transcript: Mouse NM_001161665.1

Mus musculus kinesin family member 26B (Kif26b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Kif26b (269152)
Length:
7422
CDS:
439..6777

Additional Resources:

NCBI RefSeq record:
NM_001161665.1
NBCI Gene record:
Kif26b (269152)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161665.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112886 CCTTGGCTTAAACGAGAAGAA pLKO.1 4759 CDS 100% 4.950 6.930 N Kif26b n/a
2 TRCN0000112888 CCACTACGAATGCTTGTCGTT pLKO.1 5460 CDS 100% 2.640 3.696 N Kif26b n/a
3 TRCN0000246343 ACGAGCTGCCCAGAAGTTAAA pLKO_005 1602 CDS 100% 13.200 10.560 N KIF26B n/a
4 TRCN0000112887 CCTGCTCATCTTATCTGAGAT pLKO.1 4458 CDS 100% 4.950 3.960 N Kif26b n/a
5 TRCN0000112889 CAGAGTACAAACCTCCCAGTT pLKO.1 3671 CDS 100% 4.050 3.240 N Kif26b n/a
6 TRCN0000283091 GAGACAACCGCTGTGACATTT pLKO_005 977 CDS 100% 13.200 9.240 N Kif26b n/a
7 TRCN0000264576 CTGCTGTGATTCACGACAAAC pLKO_005 917 CDS 100% 10.800 7.560 N Kif26b n/a
8 TRCN0000112885 CCAAACATTGTGTCCGTACTT pLKO.1 7188 3UTR 100% 4.950 3.465 N Kif26b n/a
9 TRCN0000190281 CTGGTCCCTTTCAAGAACCAA pLKO.1 1392 CDS 100% 3.000 2.100 N Kif26b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161665.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.