Transcript: Mouse NM_001161667.1

Mus musculus acyl-Coenzyme A oxidase 2, branched chain (Acox2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Acox2 (93732)
Length:
2448
CDS:
148..2193

Additional Resources:

NCBI RefSeq record:
NM_001161667.1
NBCI Gene record:
Acox2 (93732)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076778 GCGAGTAAACTGGTACATGAA pLKO.1 2296 3UTR 100% 4.950 3.960 N Acox2 n/a
2 TRCN0000076779 CCTGCCTATAAGAAGTATATT pLKO.1 2137 CDS 100% 15.000 10.500 N Acox2 n/a
3 TRCN0000076782 ACCCTGCCTATAAGAAGTATA pLKO.1 2135 CDS 100% 13.200 9.240 N Acox2 n/a
4 TRCN0000076781 CCAGGCTCATAAGAGATGCAA pLKO.1 1670 CDS 100% 3.000 2.100 N Acox2 n/a
5 TRCN0000076780 CCAGTGTTTAATTTGAAGCAT pLKO.1 328 CDS 100% 3.000 2.100 N Acox2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.