Transcript: Mouse NM_001163014.1

Mus musculus glycoprotein 6 (platelet) (Gp6), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gp6 (243816)
Length:
1152
CDS:
61..1002

Additional Resources:

NCBI RefSeq record:
NM_001163014.1
NBCI Gene record:
Gp6 (243816)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089060 CCTATGAATATCACTGCCTCT pLKO.1 784 CDS 100% 2.160 1.728 N Gp6 n/a
2 TRCN0000089062 GATCAAGACTTTCTCTTCATT pLKO.1 268 CDS 100% 5.625 3.938 N Gp6 n/a
3 TRCN0000089058 GCAACACAGGATGAGAGCTTT pLKO.1 948 CDS 100% 4.950 3.465 N Gp6 n/a
4 TRCN0000089059 GCTGTGTGTACTGCAAGTGAT pLKO.1 96 CDS 100% 4.950 3.465 N Gp6 n/a
5 TRCN0000089061 CCAACCATGGAAAGAAGTAAT pLKO.1 289 CDS 100% 13.200 7.920 N Gp6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.