Transcript: Mouse NM_001163138.1

Mus musculus caspase recruitment domain family, member 6 (Card6), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Card6 (239319)
Length:
4531
CDS:
58..3585

Additional Resources:

NCBI RefSeq record:
NM_001163138.1
NBCI Gene record:
Card6 (239319)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000450297 GCCAGTCAAGAACGGATAATG pLKO_005 2725 CDS 100% 13.200 18.480 N Card6 n/a
2 TRCN0000453579 GTGATCTTTGCTTAAGCTATT pLKO_005 3613 3UTR 100% 10.800 15.120 N Card6 n/a
3 TRCN0000092173 GCCAAATCATACGTGCAAGAT pLKO.1 4167 3UTR 100% 4.950 6.930 N Card6 n/a
4 TRCN0000092174 GCCAGATGATTCGCTGTACTT pLKO.1 645 CDS 100% 4.950 6.930 N Card6 n/a
5 TRCN0000452620 ACTCTATCTTGGACACGTTAA pLKO_005 137 CDS 100% 10.800 7.560 N Card6 n/a
6 TRCN0000453118 CCGAGACCCACTCAACCTAAA pLKO_005 3505 CDS 100% 10.800 7.560 N Card6 n/a
7 TRCN0000092177 CCCAGCAAGTATCACCTTCTT pLKO.1 600 CDS 100% 4.950 3.465 N Card6 n/a
8 TRCN0000092175 CCACTTTAGATCACAGCAGAA pLKO.1 2280 CDS 100% 4.050 2.835 N Card6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.