Transcript: Mouse NM_001163155.1

Mus musculus collagen, type IV, alpha 5 (Col4a5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Col4a5 (12830)
Length:
6503
CDS:
317..5392

Additional Resources:

NCBI RefSeq record:
NM_001163155.1
NBCI Gene record:
Col4a5 (12830)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090471 GCCAGGTCTTAATGGAATGAA pLKO.1 4273 CDS 100% 5.625 7.875 N Col4a5 n/a
2 TRCN0000082835 GCTCCCTTCATCGAATGTCAT pLKO.1 5213 CDS 100% 4.950 6.930 N COL4A5 n/a
3 TRCN0000090472 CCAGGAAATATGGGACCTACA pLKO.1 2156 CDS 100% 4.050 2.835 N Col4a5 n/a
4 TRCN0000090469 CCAGGTGATAAAGGACTCCAA pLKO.1 1700 CDS 100% 2.640 1.848 N Col4a5 n/a
5 TRCN0000090470 GCCTTTCATGTTCTGCAACAT pLKO.1 4882 CDS 100% 0.495 0.347 N Col4a5 n/a
6 TRCN0000090468 GCTCCATCCTTCCTTATGAAA pLKO.1 5609 3UTR 100% 5.625 3.375 N Col4a5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.