Transcript: Mouse NM_001163592.1

Mus musculus NHS-like 1 (Nhsl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Nhsl1 (215819)
Length:
6812
CDS:
128..4879

Additional Resources:

NCBI RefSeq record:
NM_001163592.1
NBCI Gene record:
Nhsl1 (215819)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247115 AGTAGCGTCAAGTCGGAATAC pLKO_005 2405 CDS 100% 10.800 15.120 N Nhsl1 n/a
2 TRCN0000189518 CCGCAAATGATGACCTGACAT pLKO.1 6479 3UTR 100% 4.950 6.930 N Nhsl1 n/a
3 TRCN0000247112 TTTCCTCAAATCCCGAAATAG pLKO_005 3439 CDS 100% 13.200 10.560 N Nhsl1 n/a
4 TRCN0000201671 GCTGGATTTGTTTCCTGCTTA pLKO.1 5695 3UTR 100% 4.950 3.465 N Nhsl1 n/a
5 TRCN0000247114 TAGAGTGTACAACCGTATTTA pLKO_005 6202 3UTR 100% 15.000 9.000 N Nhsl1 n/a
6 TRCN0000247113 GCCGAAGTTCTCAGTACTATT pLKO_005 366 CDS 100% 13.200 7.920 N Nhsl1 n/a
7 TRCN0000190065 GAAGACCTGTTTGCAGCCATT pLKO.1 4148 CDS 100% 4.050 2.430 N Nhsl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.