Transcript: Mouse NM_001163608.1

Mus musculus plexin domain containing 1 (Plxdc1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Plxdc1 (72324)
Length:
2922
CDS:
131..1654

Additional Resources:

NCBI RefSeq record:
NM_001163608.1
NBCI Gene record:
Plxdc1 (72324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124135 CGCATTGTCTTCGGCTACAAA pLKO.1 842 CDS 100% 5.625 7.875 N Plxdc1 n/a
2 TRCN0000124136 GACGCTTTCATGATTCTCAAT pLKO.1 926 CDS 100% 4.950 6.930 N Plxdc1 n/a
3 TRCN0000124138 ACTTTGACAATGGGACCGTTT pLKO.1 735 CDS 100% 4.050 2.835 N Plxdc1 n/a
4 TRCN0000124134 GCTCAGTAATACAACTGCGAA pLKO.1 1821 3UTR 100% 2.640 1.848 N Plxdc1 n/a
5 TRCN0000124137 CCGCCAAGAATGGCTGACCTA pLKO.1 1168 CDS 100% 0.880 0.616 N Plxdc1 n/a
6 TRCN0000060927 GACACCAAGTTGAATCCCTAT pLKO.1 1340 CDS 100% 4.050 2.835 N PLXDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.