Transcript: Mouse NM_001163614.1

Mus musculus achaete-scute family bHLH transcription factor 4 (Ascl4), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ascl4 (67341)
Length:
1157
CDS:
1..435

Additional Resources:

NCBI RefSeq record:
NM_001163614.1
NBCI Gene record:
Ascl4 (67341)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240119 GGAAACTCAATTCTCGTATTT pLKO_005 644 3UTR 100% 13.200 18.480 N Ascl4 n/a
2 TRCN0000256968 ACAGCGATGGCGAGTCCAAAG pLKO_005 368 CDS 100% 2.000 2.800 N Ascl4 n/a
3 TRCN0000240118 AGCGTAGCTAGCAGCATCCTA pLKO_005 425 CDS 100% 3.000 2.100 N Ascl4 n/a
4 TRCN0000240117 ATCAGCTACATCAAGCAACTG pLKO_005 313 CDS 100% 4.050 2.430 N Ascl4 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 749 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.