Transcript: Human NM_001163629.1

Homo sapiens maestro heat like repeat family member 9 (MROH9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
MROH9 (80133)
Length:
3165
CDS:
155..2740

Additional Resources:

NCBI RefSeq record:
NM_001163629.1
NBCI Gene record:
MROH9 (80133)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001163629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142837 CAGAAGACACTGTCATCGTAT pLKO.1 1713 CDS 100% 4.950 6.930 N MROH9 n/a
2 TRCN0000145443 GCAGCATCCATACTGATATTT pLKO.1 980 CDS 100% 15.000 10.500 N MROH9 n/a
3 TRCN0000144459 CGTGCTGAAGACAATCTTATT pLKO.1 1237 CDS 100% 13.200 9.240 N MROH9 n/a
4 TRCN0000145007 GCAGTTTGAATCTCAGTTGAA pLKO.1 325 CDS 100% 4.950 3.465 N MROH9 n/a
5 TRCN0000140992 CAGTGTGAAATGGCACCACAT pLKO.1 205 CDS 100% 4.050 2.835 N MROH9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.