Transcript: Mouse NM_001163706.1

Mus musculus F-box protein 6 (Fbxo6), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fbxo6 (50762)
Length:
1205
CDS:
118..1005

Additional Resources:

NCBI RefSeq record:
NM_001163706.1
NBCI Gene record:
Fbxo6 (50762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163706.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087106 ACCGGAAGAAACTGTAGTAAT pLKO.1 903 CDS 100% 13.200 18.480 N Fbxo6 n/a
2 TRCN0000317510 ACCGGAAGAAACTGTAGTAAT pLKO_005 903 CDS 100% 13.200 18.480 N Fbxo6 n/a
3 TRCN0000313927 CAACAAGGTCAAGAAGTATTT pLKO_005 468 CDS 100% 13.200 9.240 N Fbxo6 n/a
4 TRCN0000313926 CCATGAGCACTTGCCCTATAC pLKO_005 1027 3UTR 100% 10.800 7.560 N Fbxo6 n/a
5 TRCN0000087104 CTACCGGAAGAAACTGTAGTA pLKO.1 901 CDS 100% 4.950 3.465 N Fbxo6 n/a
6 TRCN0000087107 GCCTGACATTGTGGTTAAGGA pLKO.1 576 CDS 100% 3.000 2.100 N Fbxo6 n/a
7 TRCN0000317509 GCCTGACATTGTGGTTAAGGA pLKO_005 576 CDS 100% 3.000 2.100 N Fbxo6 n/a
8 TRCN0000087103 GCAAGAGATTTCCCACACCTT pLKO.1 729 CDS 100% 2.640 1.848 N Fbxo6 n/a
9 TRCN0000313996 AGACTGGAAGGTCTTCTATAT pLKO_005 309 CDS 100% 13.200 7.920 N Fbxo6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163706.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.