Transcript: Mouse NM_001163722.1

Mus musculus small integral membrane protein 1 (Smim1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Smim1 (68859)
Length:
3380
CDS:
275..511

Additional Resources:

NCBI RefSeq record:
NM_001163722.1
NBCI Gene record:
Smim1 (68859)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346869 TAACGACTGTGGCTCCTATTT pLKO_005 965 3UTR 100% 13.200 18.480 N Smim1 n/a
2 TRCN0000346870 TACGTGCACAAGTGCAAATAA pLKO_005 491 CDS 100% 15.000 10.500 N Smim1 n/a
3 TRCN0000346872 GGAAGAAGCCTCATGCTATAG pLKO_005 361 CDS 100% 10.800 7.560 N Smim1 n/a
4 TRCN0000346868 GGCCCTCTTCTGGATCATCTT pLKO_005 445 CDS 100% 4.950 3.465 N Smim1 n/a
5 TRCN0000365607 GGCCCTCTTCTGGATCATCTT pLKO_005 445 CDS 100% 4.950 3.465 N SMIM1 n/a
6 TRCN0000346873 TGAAGTCAGCATGACCGCCAT pLKO_005 331 CDS 100% 2.160 1.512 N Smim1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.