Transcript: Human NM_001163724.2

Homo sapiens small integral membrane protein 1 (Vel blood group) (SMIM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
SMIM1 (388588)
Length:
556
CDS:
250..486

Additional Resources:

NCBI RefSeq record:
NM_001163724.2
NBCI Gene record:
SMIM1 (388588)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001163724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422700 CTATGTGCACAAGTGCAAATA pLKO_005 465 CDS 100% 13.200 9.240 N SMIM1 n/a
2 TRCN0000346868 GGCCCTCTTCTGGATCATCTT pLKO_005 420 CDS 100% 4.950 3.465 N Smim1 n/a
3 TRCN0000365607 GGCCCTCTTCTGGATCATCTT pLKO_005 420 CDS 100% 4.950 3.465 N SMIM1 n/a
4 TRCN0000376653 AGCAGGGACGGAGTCAGCCTA pLKO_005 298 CDS 100% 0.000 0.000 N SMIM1 n/a
5 TRCN0000376654 CCAGAGGCTGTGCACGGGCAA pLKO_005 366 CDS 100% 0.000 0.000 N SMIM1 n/a
6 TRCN0000365620 CCTCACGCTGCCGCAGGATCT pLKO_005 344 CDS 100% 0.000 0.000 N SMIM1 n/a
7 TRCN0000376652 CAAGCTGGGCATCGCCATGAA pLKO_005 384 CDS 100% 1.650 0.990 N SMIM1 n/a
8 TRCN0000365551 TCCAGCACAGAAGAGGCCTCA pLKO_005 328 CDS 100% 0.720 0.432 N SMIM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05586 pDONR223 100% 100% 100% None n/a
Download CSV