Transcript: Mouse NM_001163757.1

Mus musculus SKI family transcriptional corepressor 1 (Skor1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Skor1 (207667)
Length:
3613
CDS:
99..2906

Additional Resources:

NCBI RefSeq record:
NM_001163757.1
NBCI Gene record:
Skor1 (207667)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163757.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095062 GCAAATTGTCAGAGATACCTT pLKO.1 2735 CDS 100% 3.000 4.200 N Skor1 n/a
2 TRCN0000095063 CGACGACTTGGAAACCAGAAA pLKO.1 2450 CDS 100% 4.950 3.960 N Skor1 n/a
3 TRCN0000095060 CCAGAGAAGAATTGCAGAAAT pLKO.1 2593 CDS 100% 13.200 9.240 N Skor1 n/a
4 TRCN0000095061 GCTATGCCATCCAGCAGAAAT pLKO.1 2788 CDS 100% 13.200 9.240 N Skor1 n/a
5 TRCN0000095059 CCGTTGGGTTTCCCATTGTAA pLKO.1 3055 3UTR 100% 5.625 3.938 N Skor1 n/a
6 TRCN0000154319 CAGGATCAAATGAAGAGGGAA pLKO.1 2682 CDS 100% 2.640 1.848 N SKOR1 n/a
7 TRCN0000154720 GCAAATTGTCAGAGATACCCT pLKO.1 2735 CDS 100% 0.750 1.050 N SKOR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163757.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.