Transcript: Mouse NM_001163766.1

Mus musculus WD repeat domain 90 (Wdr90), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr90 (106618)
Length:
6068
CDS:
56..5734

Additional Resources:

NCBI RefSeq record:
NM_001163766.1
NBCI Gene record:
Wdr90 (106618)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346346 CCCGTTGCCAGATCCGAATTT pLKO_005 4032 CDS 100% 13.200 18.480 N Wdr90 n/a
2 TRCN0000346419 ATCACCCTTGACGGCAGATTC pLKO_005 2669 CDS 100% 10.800 15.120 N Wdr90 n/a
3 TRCN0000016682 CCTGAGGCTCAAGGGCGTCAT pLKO.1 1369 CDS 100% 0.000 0.000 N WDR90 n/a
4 TRCN0000346347 GCACTTCACACCTCGATATAA pLKO_005 3730 CDS 100% 15.000 12.000 N Wdr90 n/a
5 TRCN0000346418 GTGCACACTGACTTCGATATT pLKO_005 1796 CDS 100% 13.200 9.240 N Wdr90 n/a
6 TRCN0000353235 CAGACTGTGGATTGCTGTATG pLKO_005 5764 3UTR 100% 10.800 6.480 N Wdr90 n/a
7 TRCN0000016680 CATCCGTGTGTCTTTCTCCAA pLKO.1 520 CDS 100% 2.640 1.584 N WDR90 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.