Transcript: Mouse NM_001163847.1

Mus musculus TBC1 domain family, member 24 (Tbc1d24), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d24 (224617)
Length:
7728
CDS:
233..1918

Additional Resources:

NCBI RefSeq record:
NM_001163847.1
NBCI Gene record:
Tbc1d24 (224617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163847.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178089 GCTTGGACTTAGGTTAGGATT pLKO.1 2078 3UTR 100% 4.950 6.930 N Tbc1d24 n/a
2 TRCN0000182252 CCTCAATTACTTTGCCCGTGT pLKO.1 895 CDS 100% 2.160 3.024 N Tbc1d24 n/a
3 TRCN0000337912 CTGGAGCGAGAGGACTAAATT pLKO_005 1465 CDS 100% 15.000 12.000 N Tbc1d24 n/a
4 TRCN0000350950 AGGTGTCCTGTACCCACAATT pLKO_005 2196 3UTR 100% 13.200 9.240 N Tbc1d24 n/a
5 TRCN0000337980 GAGTCTTCCTGTATGACATTT pLKO_005 761 CDS 100% 13.200 9.240 N Tbc1d24 n/a
6 TRCN0000337910 GCCTTTGCCATCCGCCTATTT pLKO_005 1097 CDS 100% 13.200 9.240 N Tbc1d24 n/a
7 TRCN0000178120 GCAGAAGGGTATAACTGTCAA pLKO.1 1168 CDS 100% 4.950 3.465 N Tbc1d24 n/a
8 TRCN0000200449 GCTCACCTCTACAGAAGGTTA pLKO.1 3546 3UTR 100% 4.950 3.465 N Tbc1d24 n/a
9 TRCN0000177784 CCGAATGTTTGTCAAGGACAT pLKO.1 1039 CDS 100% 4.050 2.835 N Tbc1d24 n/a
10 TRCN0000176705 CGAATGTTTGTCAAGGACATT pLKO.1 1040 CDS 100% 0.495 0.347 N Tbc1d24 n/a
11 TRCN0000337978 CGAATGTTTGTCAAGGACATT pLKO_005 1040 CDS 100% 0.495 0.347 N Tbc1d24 n/a
12 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 7022 3UTR 100% 4.950 2.475 Y Gad2 n/a
13 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 7409 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163847.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.