Transcript: Mouse NM_001163945.1

Mus musculus ribosomal protein L3-like (Rpl3l), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Rpl3l (66211)
Length:
1398
CDS:
56..1279

Additional Resources:

NCBI RefSeq record:
NM_001163945.1
NBCI Gene record:
Rpl3l (66211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104107 ACGACGTAACTGACAAGTCAA pLKO.1 975 CDS 100% 4.950 6.930 N Rpl3l n/a
2 TRCN0000104106 CGACGTAACTGACAAGTCAAT pLKO.1 976 CDS 100% 4.950 6.930 N Rpl3l n/a
3 TRCN0000104105 GCGAGTGATCACTCTGAGAAA pLKO.1 1081 CDS 100% 4.950 3.960 N Rpl3l n/a
4 TRCN0000117538 CGGAGCTTCAAGACCATCTTT pLKO.1 353 CDS 100% 5.625 3.938 N RPL3L n/a
5 TRCN0000104109 GAGTGAGGTTATTGATGTCAT pLKO.1 694 CDS 100% 4.950 3.465 N Rpl3l n/a
6 TRCN0000104108 CCTGGAGAATATTGAGCTCAA pLKO.1 1132 CDS 100% 4.050 2.835 N Rpl3l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.