Transcript: Human NM_001164000.2

Homo sapiens MDS1 and EVI1 complex locus (MECOM), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-25
Taxon:
Homo sapiens (human)
Gene:
MECOM (2122)
Length:
5469
CDS:
939..4067

Additional Resources:

NCBI RefSeq record:
NM_001164000.2
NBCI Gene record:
MECOM (2122)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002532 TGCAGGGTCACTCATCTAAAG pLKO.1 4168 3UTR 100% 10.800 15.120 N MECOM n/a
2 TRCN0000002529 GCACTACGTCTTCCTTAAATA pLKO.1 1618 CDS 100% 15.000 10.500 N MECOM n/a
3 TRCN0000234041 TTAACTGGAAGTCCAATTTAA pLKO_005 1273 CDS 100% 15.000 10.500 N Mecom n/a
4 TRCN0000002531 CCTTTCTTTATGGACCCTATT pLKO.1 2838 CDS 100% 10.800 7.560 N MECOM n/a
5 TRCN0000234043 CTCAATCAATGTACCCATTTC pLKO_005 2485 CDS 100% 10.800 7.560 N Mecom n/a
6 TRCN0000002530 GCCGTTACACAGAAAGTCCAA pLKO.1 3905 CDS 100% 2.640 1.848 N MECOM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.