Transcript: Mouse NM_001164263.1

Mus musculus pleckstrin homology domain containing, family S member 1 (Plekhs1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Plekhs1 (226245)
Length:
2385
CDS:
80..1504

Additional Resources:

NCBI RefSeq record:
NM_001164263.1
NBCI Gene record:
Plekhs1 (226245)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012202 CGCCTCACTAACTGTTGTGAA pLKO.1 1048 CDS 100% 4.950 6.930 N Plekhs1 n/a
2 TRCN0000422539 CCATACTGCCAGGGTGTTAAA pLKO_005 470 CDS 100% 13.200 10.560 N Plekhs1 n/a
3 TRCN0000423336 AGTAAATCCCTGGTCTAATTA pLKO_005 1709 3UTR 100% 15.000 10.500 N Plekhs1 n/a
4 TRCN0000012201 CCACTGTAGAAGTTGGTATAA pLKO.1 306 CDS 100% 13.200 9.240 N Plekhs1 n/a
5 TRCN0000012198 CCCACATGAAATAATGACTAA pLKO.1 1622 3UTR 100% 4.950 3.465 N Plekhs1 n/a
6 TRCN0000012200 CCCACCCAAGATACAGAAGAA pLKO.1 701 CDS 100% 4.950 3.465 N Plekhs1 n/a
7 TRCN0000012199 GCCTGTTTAGAATTAGAGAAT pLKO.1 752 CDS 100% 4.950 3.465 N Plekhs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.