Transcript: Human NM_001164317.2

Homo sapiens filamin B (FLNB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
FLNB (2317)
Length:
9534
CDS:
144..8045

Additional Resources:

NCBI RefSeq record:
NM_001164317.2
NBCI Gene record:
FLNB (2317)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062506 CCGGGCACATATGTGATCTAT pLKO.1 5277 CDS 100% 0.000 0.000 N FLNB n/a
2 TRCN0000291362 CCGGGCACATATGTGATCTAT pLKO_005 5277 CDS 100% 0.000 0.000 N FLNB n/a
3 TRCN0000062507 GCCTTCAGGAATCGGGATTAA pLKO.1 7117 CDS 100% 13.200 9.240 N FLNB n/a
4 TRCN0000291363 GCCTTCAGGAATCGGGATTAA pLKO_005 7117 CDS 100% 13.200 9.240 N FLNB n/a
5 TRCN0000062504 CCAGAAATCAACAGCAGTGAT pLKO.1 6600 CDS 100% 4.950 3.465 N FLNB n/a
6 TRCN0000291361 CCAGAAATCAACAGCAGTGAT pLKO_005 6600 CDS 100% 4.950 3.465 N FLNB n/a
7 TRCN0000062505 CCTGTGGATAATGCACGAGAA pLKO.1 723 CDS 100% 4.050 2.835 N FLNB n/a
8 TRCN0000291364 CCTGTGGATAATGCACGAGAA pLKO_005 723 CDS 100% 4.050 2.835 N FLNB n/a
9 TRCN0000062503 GCTGACATTGAAATGCCCTTT pLKO.1 3516 CDS 100% 4.050 2.835 N FLNB n/a
10 TRCN0000307682 GCTGACATTGAAATGCCCTTT pLKO_005 3516 CDS 100% 4.050 2.835 N FLNB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.