Transcript: Mouse NM_001164370.1

Mus musculus mirror-image polydactyly 1 (Mipol1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mipol1 (73490)
Length:
1454
CDS:
261..1400

Additional Resources:

NCBI RefSeq record:
NM_001164370.1
NBCI Gene record:
Mipol1 (73490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367007 AGAACGTGATGAAGCTATTAT pLKO_005 659 CDS 100% 15.000 10.500 N Mipol1 n/a
2 TRCN0000376132 GACATGACATTACAGGAATTA pLKO_005 786 CDS 100% 13.200 9.240 N Mipol1 n/a
3 TRCN0000367006 TACAGCTTGCACAAATCATTA pLKO_005 1161 CDS 100% 13.200 9.240 N Mipol1 n/a
4 TRCN0000367055 TTTGGTTGAAGAAGTGTATTT pLKO_005 629 CDS 100% 13.200 9.240 N Mipol1 n/a
5 TRCN0000376071 GCAGACACTGGGATAGCTATT pLKO_005 825 CDS 100% 10.800 7.560 N Mipol1 n/a
6 TRCN0000367009 GTGATTTCTCATCAAGTTATC pLKO_005 426 CDS 100% 10.800 7.560 N Mipol1 n/a
7 TRCN0000367056 TACCTATGAAGAAGCCTTAAA pLKO_005 1226 CDS 100% 0.000 0.000 N Mipol1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.