Transcript: Human NM_001164478.1

Homo sapiens chromosome 5 open reading frame 63 (C5orf63), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
C5orf63 (401207)
Length:
966
CDS:
152..499

Additional Resources:

NCBI RefSeq record:
NM_001164478.1
NBCI Gene record:
C5orf63 (401207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365552 TGACTGATGCCCTCATGATTT pLKO_005 497 CDS 100% 13.200 18.480 N C5orf63 n/a
2 TRCN0000365554 TCTGGTATGAAAGGTATAAAT pLKO_005 366 CDS 100% 15.000 10.500 N C5orf63 n/a
3 TRCN0000365623 ACCATGGCCTGATACTCATTT pLKO_005 558 3UTR 100% 13.200 9.240 N C5orf63 n/a
4 TRCN0000370757 CCACCCTCTCTTCCCATAAAG pLKO_005 519 3UTR 100% 13.200 9.240 N C5orf63 n/a
5 TRCN0000370765 AGGAAGTACTCAAGCCTTATG pLKO_005 294 CDS 100% 10.800 7.560 N C5orf63 n/a
6 TRCN0000365555 GTGTTGACCTTATTCACAAAG pLKO_005 245 CDS 100% 10.800 7.560 N C5orf63 n/a
7 TRCN0000370703 TTCCTGTCTTTCACTTGAATG pLKO_005 393 CDS 100% 10.800 7.560 N C5orf63 n/a
8 TRCN0000365625 TCTGATGATGCATCGAGTAAA pLKO_005 421 CDS 100% 13.200 7.920 N C5orf63 n/a
9 TRCN0000377188 CTGATGATGCATCGAGTAAAT pLKO_005 422 CDS 100% 13.200 9.240 N C330018D20Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.