Transcript: Mouse NM_001164533.1

Mus musculus death associated protein 3 (Dap3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dap3 (65111)
Length:
4538
CDS:
413..1513

Additional Resources:

NCBI RefSeq record:
NM_001164533.1
NBCI Gene record:
Dap3 (65111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104455 CCTGCACTGATGGATATGAAA pLKO.1 1610 3UTR 100% 5.625 3.938 N Dap3 n/a
2 TRCN0000316406 CCTGCACTGATGGATATGAAA pLKO_005 1610 3UTR 100% 5.625 3.938 N Dap3 n/a
3 TRCN0000104458 CAAGAGAAGTATGTTTGGAAT pLKO.1 1019 CDS 100% 4.950 3.465 N Dap3 n/a
4 TRCN0000316405 CAAGAGAAGTATGTTTGGAAT pLKO_005 1019 CDS 100% 4.950 3.465 N Dap3 n/a
5 TRCN0000104456 CCAGGATCTGAAGACAGTGTT pLKO.1 622 CDS 100% 4.950 3.465 N Dap3 n/a
6 TRCN0000316408 CCAGGATCTGAAGACAGTGTT pLKO_005 622 CDS 100% 4.950 3.465 N Dap3 n/a
7 TRCN0000104457 CCTCTGGGAGAAGTTGTTGAA pLKO.1 1067 CDS 100% 4.950 3.465 N Dap3 n/a
8 TRCN0000316407 CCTCTGGGAGAAGTTGTTGAA pLKO_005 1067 CDS 100% 4.950 3.465 N Dap3 n/a
9 TRCN0000104459 CAGATGCTCATCTTTGGGTAA pLKO.1 873 CDS 100% 4.050 2.835 N Dap3 n/a
10 TRCN0000316404 CAGATGCTCATCTTTGGGTAA pLKO_005 873 CDS 100% 4.050 2.835 N Dap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.