Transcript: Mouse NM_001164604.1

Mus musculus NSE2/MMS21 homolog, SMC5-SMC6 complex SUMO ligase (Nsmce2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Nsmce2 (68501)
Length:
2745
CDS:
173..592

Additional Resources:

NCBI RefSeq record:
NM_001164604.1
NBCI Gene record:
Nsmce2 (68501)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164604.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248754 CAGGTTCTACCCGTTACATAT pLKO_005 198 CDS 100% 13.200 18.480 N Nsmce2 n/a
2 TRCN0000180249 CTTGTGGAGACTCAAACTGAA pLKO.1 314 CDS 100% 4.950 6.930 N Nsmce2 n/a
3 TRCN0000248752 GAACTCTGATGCCGACTTTAA pLKO_005 514 CDS 100% 13.200 9.240 N Nsmce2 n/a
4 TRCN0000248753 CTGTGCAGTCTACAATCAATC pLKO_005 414 CDS 100% 10.800 7.560 N Nsmce2 n/a
5 TRCN0000217461 GCCATGGTTGAGTTTGCTAAA pLKO.1 362 CDS 100% 10.800 7.560 N Nsmce2 n/a
6 TRCN0000248756 GTGAGTAGTGAGTACAGTATG pLKO_005 335 CDS 100% 10.800 7.560 N Nsmce2 n/a
7 TRCN0000181007 GCTGTGCAGTCTACAATCAAT pLKO.1 413 CDS 100% 5.625 3.938 N Nsmce2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164604.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.