Transcript: Mouse NM_001164634.1

Mus musculus solute carrier family 22 (organic anion transporter), member 8 (Slc22a8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc22a8 (19879)
Length:
3415
CDS:
228..1841

Additional Resources:

NCBI RefSeq record:
NM_001164634.1
NBCI Gene record:
Slc22a8 (19879)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000448468 GTATGGGTATCAGTAACATAT pLKO_005 1561 CDS 100% 13.200 18.480 N Slc22a8 n/a
2 TRCN0000446015 AGATTCCCTGGCAGTTCTAAT pLKO_005 2161 3UTR 100% 13.200 10.560 N Slc22a8 n/a
3 TRCN0000079466 GCTATGGGAGTAGAAGAATTT pLKO.1 1260 CDS 100% 13.200 9.240 N Slc22a8 n/a
4 TRCN0000079464 CCAGAAACTATCGAGGACATA pLKO.1 1728 CDS 100% 4.950 3.465 N Slc22a8 n/a
5 TRCN0000079465 CCTCACTGTCTATATGATCTT pLKO.1 743 CDS 100% 4.950 3.465 N Slc22a8 n/a
6 TRCN0000079467 ACCAGAAACTATCGAGGACAT pLKO.1 1727 CDS 100% 4.050 2.835 N Slc22a8 n/a
7 TRCN0000079463 CCCTACATATTAGGGTTTCTA pLKO.1 2877 3UTR 100% 0.563 0.394 N Slc22a8 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2328 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.