Transcript: Mouse NM_001164805.1

Mus musculus thrombospondin, type I, domain containing 7A (Thsd7a), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Thsd7a (330267)
Length:
11019
CDS:
301..5241

Additional Resources:

NCBI RefSeq record:
NM_001164805.1
NBCI Gene record:
Thsd7a (330267)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091672 GCCATGTTATCGGTGGCAATA pLKO.1 4281 CDS 100% 10.800 8.640 N Gm1399 n/a
2 TRCN0000091670 GCACTCATATTGTAGTGAGAT pLKO.1 4839 CDS 100% 4.950 3.465 N Gm1399 n/a
3 TRCN0000091668 GCTCTGAGAATTCTAAGAGAT pLKO.1 5435 3UTR 100% 0.000 0.000 N Gm1399 n/a
4 TRCN0000091671 GAGAAGGCAGTTTGTGGGAAT pLKO.1 3973 CDS 100% 4.050 2.430 N Gm1399 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7625 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.