Transcript: Mouse NM_001165253.1

Mus musculus melanoma inhibitory activity 2 (Mia2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mia2 (338320)
Length:
2832
CDS:
93..2411

Additional Resources:

NCBI RefSeq record:
NM_001165253.1
NBCI Gene record:
Mia2 (338320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001165253.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175257 CAAGTGAATGATCTCGATAAA pLKO.1 714 CDS 100% 13.200 18.480 N n/a
2 TRCN0000292690 CAAGTGAATGATCTCGATAAA pLKO_005 714 CDS 100% 13.200 18.480 N n/a
3 TRCN0000173797 CCGATCAATTCGAAGCCGATT pLKO.1 278 CDS 100% 4.050 5.670 N n/a
4 TRCN0000292688 CCGATCAATTCGAAGCCGATT pLKO_005 278 CDS 100% 4.050 5.670 N n/a
5 TRCN0000194525 GCAGTCATTTCCGTCTCATTT pLKO.1 2430 3UTR 100% 13.200 9.240 N n/a
6 TRCN0000175023 GCTGATTTATGCAGCTAAGTT pLKO.1 950 CDS 100% 5.625 3.938 N n/a
7 TRCN0000292687 GCTGATTTATGCAGCTAAGTT pLKO_005 950 CDS 100% 5.625 3.938 N n/a
8 TRCN0000173423 GCCTGCTAAAGATGAAGGATT pLKO.1 820 CDS 100% 4.950 3.465 N n/a
9 TRCN0000292689 GCCTGCTAAAGATGAAGGATT pLKO_005 820 CDS 100% 4.950 3.465 N n/a
10 TRCN0000174282 CAGTTTAAGTAACTGCTGTTA pLKO.1 2452 3UTR 100% 0.495 0.347 N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165253.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.