Transcript: Human NM_001166292.1

Homo sapiens patched 2 (PTCH2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
PTCH2 (8643)
Length:
4298
CDS:
13..3453

Additional Resources:

NCBI RefSeq record:
NM_001166292.1
NBCI Gene record:
PTCH2 (8643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230023 GTCTCCGCATGGCCATTATTG pLKO_005 227 CDS 100% 13.200 18.480 N PTCH2 n/a
2 TRCN0000033326 GCCAGAGGTGATACAGATGTA pLKO.1 3363 CDS 100% 4.950 3.960 N PTCH2 n/a
3 TRCN0000230025 CTGAATGGCTGCACGACAAAT pLKO_005 2660 CDS 100% 13.200 9.240 N PTCH2 n/a
4 TRCN0000218113 ACTATCAGACACATGACATTG pLKO_005 1016 CDS 100% 10.800 7.560 N PTCH2 n/a
5 TRCN0000218545 CCACTTTGACTTCATTGTAAG pLKO_005 3249 CDS 100% 10.800 7.560 N PTCH2 n/a
6 TRCN0000230024 TGCCAGTAAAGTCCAAGTATC pLKO_005 435 CDS 100% 10.800 7.560 N PTCH2 n/a
7 TRCN0000088377 CGGATGATTGAGAAGCTGTTT pLKO.1 535 CDS 100% 4.950 3.465 N Ptch2 n/a
8 TRCN0000033328 CGTACTCACATCCATCAACAA pLKO.1 1518 CDS 100% 4.950 3.465 N PTCH2 n/a
9 TRCN0000033327 GCTGCATTACACCAAGGAGAA pLKO.1 300 CDS 100% 4.050 2.835 N PTCH2 n/a
10 TRCN0000033324 CCCACTTTGACTTCATTGTAA pLKO.1 3248 CDS 100% 5.625 3.375 N PTCH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.