Transcript: Mouse NM_001166391.1

Mus musculus coagulation factor XIII, A1 subunit (F13a1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
F13a1 (74145)
Length:
3854
CDS:
69..2267

Additional Resources:

NCBI RefSeq record:
NM_001166391.1
NBCI Gene record:
F13a1 (74145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104690 CCCACATTAACAAATTGCATT pLKO.1 2890 3UTR 100% 4.950 6.930 N F13a1 n/a
2 TRCN0000104691 CGGGAAGCTAATTGTGACCAA pLKO.1 1451 CDS 100% 2.640 3.696 N F13a1 n/a
3 TRCN0000055632 GCTGGTGTCTTTAACACATTT pLKO.1 1023 CDS 100% 13.200 10.560 N F13A1 n/a
4 TRCN0000104692 CCTGAATGACATTGGAGTGAT pLKO.1 686 CDS 100% 4.950 3.465 N F13a1 n/a
5 TRCN0000104693 CCTTGAAACTGCTCTGATGTA pLKO.1 1550 CDS 100% 4.950 3.465 N F13a1 n/a
6 TRCN0000104694 GCAGAGGTCAACAGTGATCTT pLKO.1 1368 CDS 100% 4.950 3.465 N F13a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.