Transcript: Human NM_001166412.2

Homo sapiens SPARC related modular calcium binding 2 (SMOC2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
SMOC2 (64094)
Length:
3082
CDS:
188..1528

Additional Resources:

NCBI RefSeq record:
NM_001166412.2
NBCI Gene record:
SMOC2 (64094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373548 CAAGGTACGAGCAGCCGAAAT pLKO_005 1008 CDS 100% 10.800 15.120 N SMOC2 n/a
2 TRCN0000053446 GTCATGCTGAAAGTACGTCTA pLKO.1 1482 CDS 100% 4.050 5.670 N SMOC2 n/a
3 TRCN0000373620 CCTCACCAAAGAGCAATTAAG pLKO_005 1574 3UTR 100% 13.200 9.240 N SMOC2 n/a
4 TRCN0000053443 GTGACGTGAATAATGACAAAT pLKO.1 1374 CDS 100% 13.200 9.240 N SMOC2 n/a
5 TRCN0000053445 CCTTTGGACTGAACAGGTTAA pLKO.1 772 CDS 100% 10.800 7.560 N SMOC2 n/a
6 TRCN0000053444 CCTTCCTTTCCCGTTGTGAAT pLKO.1 363 CDS 100% 4.950 3.465 N SMOC2 n/a
7 TRCN0000053447 GCCCGGAAGGAGTTTCAGCAA pLKO.1 488 CDS 100% 0.880 0.616 N SMOC2 n/a
8 TRCN0000373621 TGAATGCATTTAGGCTTAATT pLKO_005 1783 3UTR 100% 15.000 9.000 N SMOC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.