Transcript: Mouse NM_001166556.1

Mus musculus ATP-binding cassette, sub-family A (ABC1), member 6 (Abca6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Abca6 (76184)
Length:
1523
CDS:
217..1383

Additional Resources:

NCBI RefSeq record:
NM_001166556.1
NBCI Gene record:
Abca6 (76184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113435 GCACAATATACCGGACGCTTT pLKO.1 570 CDS 100% 4.050 5.670 N Abca6 n/a
2 TRCN0000113436 GCAATGTTACTAAAGAGAGAA pLKO.1 935 CDS 100% 4.950 3.465 N Abca6 n/a
3 TRCN0000113439 CCAATTATTATAGGACTGCAT pLKO.1 325 CDS 100% 2.640 1.848 N Abca6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.