Transcript: Mouse NM_001166711.1

Mus musculus predicted gene 5725 (Gm5725), mRNA.

Source:
NCBI, updated 2014-01-15
Taxon:
Mus musculus (mouse)
Gene:
Gm5725 (435940)
Length:
924
CDS:
1..924

Additional Resources:

NCBI RefSeq record:
NM_001166711.1
NBCI Gene record:
Gm5725 (435940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166711.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272280 GACTCTATTCCTCACTATATT pLKO_005 192 CDS 100% 15.000 7.500 Y Vmn1r132 n/a
2 TRCN0000420054 TCTTTCTGTTTGTCCATAATT pLKO_005 95 CDS 100% 15.000 7.500 Y Vmn1r148 n/a
3 TRCN0000193299 CCAACTGAACTCAAATGTAAA pLKO.1 250 CDS 100% 13.200 6.600 Y Vmn1r93 n/a
4 TRCN0000430457 CTCCTCCAACTGAACTCAAAT pLKO_005 245 CDS 100% 13.200 6.600 Y Vmn1r148 n/a
5 TRCN0000126503 GTCACAAACATGGCAAGTTAT pLKO.1 400 CDS 100% 13.200 6.600 Y Vmn1r183 n/a
6 TRCN0000203053 GTCTTTCTGTTTGTCCATAAT pLKO.1 94 CDS 100% 13.200 6.600 Y Vmn1r122 n/a
7 TRCN0000126888 TCCACAGATAACAGACAATAA pLKO.1 486 CDS 100% 13.200 6.600 Y Vmn1r180 n/a
8 TRCN0000425110 CAGTCTTGACTGGTTCTAAAC pLKO_005 122 CDS 100% 10.800 5.400 Y Vmn1r148 n/a
9 TRCN0000187323 CAGAGCAAGTGTCACAAACAT pLKO.1 390 CDS 100% 5.625 2.813 Y Gm5726 n/a
10 TRCN0000125257 CCTCACTATATTTCCAAACAA pLKO.1 201 CDS 100% 5.625 2.813 Y V1rd19 n/a
11 TRCN0000186528 GTCCAAAGCAACCCATACTAT pLKO.1 705 CDS 100% 5.625 2.813 Y Gm5725 n/a
12 TRCN0000203741 CATCCTCACTCCCAATCAGAA pLKO.1 666 CDS 100% 4.950 2.475 Y Vmn1r122 n/a
13 TRCN0000187107 CTTGACTCTATTCCTCACTAT pLKO.1 189 CDS 100% 4.950 2.475 Y Vmn1r159 n/a
14 TRCN0000186527 GTTCTGTTCCACTTCTGGATT pLKO.1 528 CDS 100% 4.950 2.475 Y Gm5725 n/a
15 TRCN0000187787 GTCTTCTTGCAGTTTGCCTAT pLKO.1 562 CDS 100% 4.050 2.025 Y Vmn1r159 n/a
16 TRCN0000126500 GCTCTTCAGATCCTCTTGCTT pLKO.1 43 CDS 100% 3.000 1.500 Y Vmn1r183 n/a
17 TRCN0000187949 GCTCTTCAGATCCTCTTGCTT pLKO.1 43 CDS 100% 3.000 1.500 Y Vmn1r122 n/a
18 TRCN0000189046 GCCTTGACTCTATTCCTCACT pLKO.1 187 CDS 100% 2.640 1.320 Y Vmn1r159 n/a
19 TRCN0000194278 CCAATTAAGTTCAGTGGTCCA pLKO.1 469 CDS 100% 2.160 1.080 Y Gm5726 n/a
20 TRCN0000193932 CCAGTCTTGACTGGTTCTAAA pLKO.1 121 CDS 100% 1.320 0.660 Y Vmn1r178 n/a
21 TRCN0000126499 CCACAGATAACAGACAATAAT pLKO.1 487 CDS 100% 15.000 7.500 Y Vmn1r183 n/a
22 TRCN0000185201 CATGGCAAGTTATTCTTCTTA pLKO.1 408 CDS 100% 5.625 2.813 Y Gm5725 n/a
23 TRCN0000186233 CTGTTCCACTTCTGGATTCAT pLKO.1 531 CDS 100% 5.625 2.813 Y Vmn1r151 n/a
24 TRCN0000187324 CATCCTCACTCCCAATCAGTA pLKO.1 666 CDS 100% 4.950 2.475 Y Vmn1r151 n/a
25 TRCN0000187400 CCTTGACTCTATTCCTCACAA pLKO.1 188 CDS 100% 4.950 2.475 Y Vmn1r113 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166711.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.