Transcript: Mouse NM_001167730.1

Mus musculus RAD18 E3 ubiquitin protein ligase (Rad18), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rad18 (58186)
Length:
2701
CDS:
77..1747

Additional Resources:

NCBI RefSeq record:
NM_001167730.1
NBCI Gene record:
Rad18 (58186)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124780 CGGATGATTCTTCTAGTTGTA pLKO.1 1524 CDS 100% 4.950 6.930 N Rad18 n/a
2 TRCN0000317328 CGGATGATTCTTCTAGTTGTA pLKO_005 1524 CDS 100% 4.950 6.930 N Rad18 n/a
3 TRCN0000124783 CCGTCGATGAGAACAGATGAA pLKO.1 1301 CDS 100% 4.950 6.435 N Rad18 n/a
4 TRCN0000317327 CCGTCGATGAGAACAGATGAA pLKO_005 1301 CDS 100% 4.950 6.435 N Rad18 n/a
5 TRCN0000124782 GCGGTGATGAAGACAATAGAT pLKO.1 116 CDS 100% 5.625 3.938 N Rad18 n/a
6 TRCN0000317255 GCGGTGATGAAGACAATAGAT pLKO_005 116 CDS 100% 5.625 3.938 N Rad18 n/a
7 TRCN0000124781 GCTGCTGAAATCGTCCAAGAA pLKO.1 965 CDS 100% 4.950 3.465 N Rad18 n/a
8 TRCN0000124779 CCTGAGAAATAATCGCCTCTT pLKO.1 289 CDS 100% 4.050 2.430 N Rad18 n/a
9 TRCN0000317326 CCTGAGAAATAATCGCCTCTT pLKO_005 289 CDS 100% 4.050 2.430 N Rad18 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1911 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.