Transcript: Mouse NM_001167736.1

Mus musculus coiled-coil-helix-coiled-coil-helix domain containing 6 (Chchd6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Chchd6 (66098)
Length:
1042
CDS:
108..845

Additional Resources:

NCBI RefSeq record:
NM_001167736.1
NBCI Gene record:
Chchd6 (66098)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240967 TGAAGAAGGGACCGATCATAG pLKO_005 870 3UTR 100% 10.800 15.120 N Chchd6 n/a
2 TRCN0000240968 GGCCCTCTGACAGACGTTAAA pLKO_005 405 CDS 100% 13.200 10.560 N Chchd6 n/a
3 TRCN0000240965 AGCAGTGAAGGAGGATCTTAA pLKO_005 464 CDS 100% 13.200 9.240 N Chchd6 n/a
4 TRCN0000240969 TAAACTGTCTTCCCAACAATT pLKO_005 647 CDS 100% 13.200 9.240 N Chchd6 n/a
5 TRCN0000240966 AGTGTTGTGAACCGCATGAAG pLKO_005 204 CDS 100% 4.950 3.465 N Chchd6 n/a
6 TRCN0000177821 GAAGGAGGATCTTAAGAAGTT pLKO.1 470 CDS 100% 4.950 3.465 N Chchd6 n/a
7 TRCN0000182486 GACCATCTGCATGAAGTGCTT pLKO.1 765 CDS 100% 2.640 1.848 N Chchd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.