Transcript: Mouse NM_001167818.1

Mus musculus renalase, FAD-dependent amine oxidase (Rnls), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rnls (67795)
Length:
1632
CDS:
350..1252

Additional Resources:

NCBI RefSeq record:
NM_001167818.1
NBCI Gene record:
Rnls (67795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339176 CTGCCAGCAGTCCTCATAATC pLKO_005 357 CDS 100% 13.200 10.560 N Rnls n/a
2 TRCN0000339114 GGTGACATTGTGAACTTAATT pLKO_005 734 CDS 100% 15.000 10.500 N Rnls n/a
3 TRCN0000339113 GGCGGATGTGCAGAAGTTAAT pLKO_005 1000 CDS 100% 13.200 9.240 N Rnls n/a
4 TRCN0000339178 TGATAATAAGAAGCGCAATAT pLKO_005 901 CDS 100% 13.200 9.240 N Rnls n/a
5 TRCN0000339177 CTCAGCCAGTTGCTACCATAT pLKO_005 1056 CDS 100% 10.800 7.560 N Rnls n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.