Transcript: Mouse NM_001167923.1

Mus musculus collagen, type VI, alpha 5 (Col6a5), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Col6a5 (665033)
Length:
9297
CDS:
127..8049

Additional Resources:

NCBI RefSeq record:
NM_001167923.1
NBCI Gene record:
Col6a5 (665033)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091860 CCGAGACTTTAATAAGCTAAA pLKO.1 3711 CDS 100% 10.800 8.640 N Col6a5 n/a
2 TRCN0000091735 GATGACTTCCAAGCCGTGAAA pLKO.1 6154 CDS 100% 4.950 3.960 N Gm520 n/a
3 TRCN0000091736 GACGTGGCTTTCCTCATAGAT pLKO.1 7087 CDS 100% 5.625 3.938 N Gm520 n/a
4 TRCN0000091733 CCATCACATCTACATCTCAAA pLKO.1 8372 3UTR 100% 4.950 3.465 N Gm520 n/a
5 TRCN0000091734 CTATGTCATCAAGTTCATCAA pLKO.1 7656 CDS 100% 4.950 3.465 N Gm520 n/a
6 TRCN0000091858 GCCATCACATCTACATCTCAA pLKO.1 8371 3UTR 100% 4.950 3.465 N Col6a5 n/a
7 TRCN0000091737 TGCCTTTACAACCTACGACAA pLKO.1 6312 CDS 100% 4.050 2.835 N Gm520 n/a
8 TRCN0000091861 CGCAATGAAATCTGGACCCAA pLKO.1 1462 CDS 100% 2.640 1.848 N Col6a5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.