Transcript: Mouse NM_001168295.1

Mus musculus serine (or cysteine) peptidase inhibitor, clade A, member 3F (Serpina3f), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Serpina3f (238393)
Length:
2042
CDS:
90..1427

Additional Resources:

NCBI RefSeq record:
NM_001168295.1
NBCI Gene record:
Serpina3f (238393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086710 GCTGGAAATTATGCCTGAATA pLKO.1 1361 CDS 100% 13.200 18.480 N Serpina3f n/a
2 TRCN0000086709 CTCCAATGTTGTCAAGGTGTA pLKO.1 1194 CDS 100% 4.050 3.240 N Serpina3f n/a
3 TRCN0000086708 GCCCAGTTCTACCTTACTCTT pLKO.1 1751 3UTR 100% 4.950 3.465 N Serpina3f n/a
4 TRCN0000086711 GTTTCAAATCCAGAGAGTGAT pLKO.1 1302 CDS 100% 4.950 3.465 N Serpina3f n/a
5 TRCN0000087147 GATGATTATCTCTGACACAAA pLKO.1 1253 CDS 100% 4.950 2.475 Y Serpina3g n/a
6 TRCN0000086712 GCTGGTGAATTACATCTACTT pLKO.1 671 CDS 100% 4.950 2.475 Y Serpina3f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.