Transcript: Human NM_001168378.1

Homo sapiens Zic family member 4 (ZIC4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ZIC4 (84107)
Length:
4152
CDS:
187..1341

Additional Resources:

NCBI RefSeq record:
NM_001168378.1
NBCI Gene record:
ZIC4 (84107)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001168378.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413571 GGCACTTGTACCCGATCATAA pLKO_005 1667 3UTR 100% 13.200 18.480 N ZIC4 n/a
2 TRCN0000433896 GACATAATATTTACGTCTAAC pLKO_005 1551 3UTR 100% 10.800 15.120 N ZIC4 n/a
3 TRCN0000074198 GCCGTTAATAAGAAGGAGAAT pLKO.1 3348 3UTR 100% 4.950 6.930 N ZIC4 n/a
4 TRCN0000074202 GCTCTGGCTACGATTCGGCTA pLKO.1 1220 CDS 100% 0.720 1.008 N ZIC4 n/a
5 TRCN0000415812 GGGAAGGTCTTTGCTAGATCA pLKO_005 970 CDS 100% 4.950 3.960 N ZIC4 n/a
6 TRCN0000074199 GCTTTACCGAAACACTCTTAA pLKO.1 378 CDS 100% 13.200 9.240 N ZIC4 n/a
7 TRCN0000074200 ACACTCTTAAAGAGTCAAGTA pLKO.1 389 CDS 100% 4.950 3.465 N ZIC4 n/a
8 TRCN0000074201 GCCCTTCAAAGCCAAATACAA pLKO.1 885 CDS 100% 5.625 2.813 Y ZIC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168378.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.