Transcript: Mouse NM_001168498.1

Mus musculus noncompact myelin associated protein (Ncmap), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ncmap (230822)
Length:
1635
CDS:
341..643

Additional Resources:

NCBI RefSeq record:
NM_001168498.1
NBCI Gene record:
Ncmap (230822)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265045 GAGAGGACGCCCTGTATAAGA pLKO_005 396 CDS 100% 5.625 7.875 N Ncmap n/a
2 TRCN0000265044 CCGTCTTCTCGCTGAACATGA pLKO_005 369 CDS 100% 4.950 6.930 N Ncmap n/a
3 TRCN0000283266 GACGGCTAGACAGCTTGATAG pLKO_005 927 3UTR 100% 10.800 8.640 N Ncmap n/a
4 TRCN0000191831 GAAACTAACTTGGACTAACTA pLKO.1 1074 3UTR 100% 5.625 4.500 N Ncmap n/a
5 TRCN0000265043 GATCCTGCTGAAGATGTACAA pLKO_005 478 CDS 100% 4.950 3.465 N Ncmap n/a
6 TRCN0000201940 CATCATTGTCACCTTGGTGCT pLKO.1 457 CDS 100% 2.160 1.512 N Ncmap n/a
7 TRCN0000162209 CTGAAGATGTACAACAGGAAA pLKO.1 485 CDS 100% 4.950 3.465 N NCMAP n/a
8 TRCN0000163334 GCTGAAGATGTACAACAGGAA pLKO.1 484 CDS 100% 2.640 1.848 N NCMAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.