Transcript: Mouse NM_001168502.1

Mus musculus zinc finger protein 57 (Zfp57), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zfp57 (22715)
Length:
2088
CDS:
624..1880

Additional Resources:

NCBI RefSeq record:
NM_001168502.1
NBCI Gene record:
Zfp57 (22715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256683 CCTATTGTCACATAACGTTTA pLKO_005 1414 CDS 100% 10.800 15.120 N Zfp57 n/a
2 TRCN0000124101 CGACGTGCTCATTTAGGTTAT pLKO.1 1089 CDS 100% 10.800 15.120 N Zfp57 n/a
3 TRCN0000124102 CCGACGTGCTCATTTAGGTTA pLKO.1 1088 CDS 100% 4.950 6.930 N Zfp57 n/a
4 TRCN0000124099 CCTGACATTTGTCGGAAGCAA pLKO.1 764 CDS 100% 3.000 4.200 N Zfp57 n/a
5 TRCN0000256682 ACCCGTGGTGCTGGGAAATAT pLKO_005 1682 CDS 100% 15.000 12.000 N Zfp57 n/a
6 TRCN0000256685 ATGTCAGATCCAACTCTATTA pLKO_005 1360 CDS 100% 13.200 9.240 N Zfp57 n/a
7 TRCN0000256684 TAGCTCAGATCTGCAAGATAA pLKO_005 803 CDS 100% 13.200 9.240 N Zfp57 n/a
8 TRCN0000256681 TGGGAAATCCTGGGTCATTTG pLKO_005 1644 CDS 100% 10.800 7.560 N Zfp57 n/a
9 TRCN0000124100 GCTGCCAAAGACCAATCAGAT pLKO.1 1612 CDS 100% 4.950 3.465 N Zfp57 n/a
10 TRCN0000124103 CCAACACACTCAGAATGCAAA pLKO.1 1525 CDS 100% 4.950 2.970 N Zfp57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.